to top page


TOP > November 2010 >Unclassified >1354

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1354November 2010UnclassifiedUncultured ectomycorrhizal fungusFM999526
91
5
324
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGAACTTTGAAGGGGAGAGGGGAAGGCTGTCGCTGGCTCTCTCGAGCATGTGCACGCCTTTCCTTCTCTTCATGCAAACCTACACCTGTGCACCCATTGTAGGCCCTCGAAAGAGGATCTACGTATTTCATACAACACCCACTTAGCATGTCCATAGAATGTCAAATCATAGGATCGTCCTTCGGGGCGGTATCTACGAAAATCAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGC