to top page


TOP > November 2010 >Unclassified >1353

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1353November 2010UnclassifiedFungal sp.HQ685126
99
1
345
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACTAGAGCAAAGGATAGACAGCGTCCGTGGAGCTCGCTCCCGGGGCCACCCTACTCCGGTAGGGTTTAGAGTCGTCGAGCCTCTCGAAGAAGCTCGGTCCTGAACTCCACCCTTGAATAAACTACCTTTGTTGCTTTGGCGGGCCGCCTCGTGCCAGCGGCTTCGGCTGTTGAGTGCCCGCCAGAGGACCACAACTCTTGTTTTAGTGATGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGATCTCTTGGTCTGGCATCGATGAAGAACGC