to top page


TOP > November 2010 >Unclassified >1351

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1351November 2010UnclassifiedUncultured fungusFN812813
100
1
291
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTCTCCGTAGGTGAACCTGCGGAGGGATCATTACAGAGTTCGTGCCCTCACGGGTAGATCTCCCCACCCTTGTGTATCTCCGTATTCTTGTTGCTTTGGCAGGCCGCTGGGCTTCGGCCTGGCCACCGGCTCTGGGGCTGGTGCGCGCCTGCCAGAGGACCTCTCAAACTCGGTTTGTTACTGTCGTCTGAGTACTATAACAATCGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGC