to top page


TOP > November 2010 >Unclassified >1349

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1349November 2010UnclassifiedUncultured fungusAB581133
93
1
313
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATAGAATTGTTCGAATCCATACGGGCATTTTCTAAAAATCCGTATCCACACCGGTAGGGTTTTCTTTTTCTTTTGGGGAAAAAAAACCCTTACCGTAGGGTTCCTCATTCGCTTTTCGGAGCGGGTGTGGTTCCTGTCTGACTTATGCCTATAATTTTATTTTGTCTGAACTTGTTTATAAAAAATAATAAACAAAACAACTTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCA