to top page


TOP > November 2010 >Unclassified >1348

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1348November 2010UnclassifiedUncultured soil fungusJX489782
95
1
278
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACAGAGTTGCAAAACTCCCTAAACCCTTTGTTTATATACCTGTTCAGTTGCTTCGGTAGGCGGCCCCAGGGCGGGGCCTCCAGCCTGCTCACGCAGGTGCCTGCCGCTGGCGTAAAAACTCTTGTTATATATTATTATTCTGAGTCACAAAAAAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGC