to top page


TOP > November 2010 >Unclassified >1347

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1347November 2010UnclassifiedUncultured ectomycorrhizal fungusFM999514
95
3
300
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAATGAATTGTAATCGGAGTTGATGCTGGCAGCTTGGCTGCATGTGCTCGCTCCTAACAATCTTCATCCAAACACCTGTGCACATATTTAGAGAGGGTCTTCGAGTTATCCTTGGAGTCCCTTCCTCTTATCACACACTTTAGTTTAATATTGAACGTGATTGTGCCGTCAGGCCTTAATATTGATACAACTTTTAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGC