to top page


TOP > November 2010 >Unclassified >1346

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1346November 2010UnclassifiedUncultured soil fungusDQ420987
97
4
313
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTCACGTGCTCAAACAACCCTTCTGTGGACCTGAATTAAACCGTTGCCTCGGCGGGCGGTCCCCTGCCAAAACCCACGTGGTTGTGGACAGAGGACCAGACAGTCCGGCACGCTTAAGGCGTCCGGCGCCAGCCGCTGGCCCAATTAAACTCTAGTAACCTTACCTTCTGAGTTTTAATGCAAAAAATAAGTCAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGC