to top page


TOP > November 2010 >Unclassified >1341

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1341November 2010UnclassifiedUncultured fungusJN397020
89
1
281
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTCAAAATAAAAGTGAATTTTATGGCACTTTTAAAAAATCCATATCCACCTTGTGTGCAATGTAATTTTGAAAGAGGATTTATTTCCTCTTTCTAAAATCATATCAACTCTTTGCTTTGAACCTGTTTGTCTGATATAAAATATTCTTGAATAACTTAATTCAAAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGC