to top page


TOP > November 2010 >Unclassified >1340

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1340November 2010UnclassifiedUncultured fungusAJ875391
92
1
265
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACAGAGTTGCAAAACTCCCTAAACCATCGTGAACCCACCCCTAAACAGTTGCTTCGGCGGCGCCCAGGGCCCCGCGCCCCAGGCCCGCCGGAGACCCCCAAACTCTTGTTTTTACACTGGCCTCTCTGAGTACTGTACTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCA