to top page


TOP > November 2010 >Unclassified >1338

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1338November 2010UnclassifiedUncultured fungusGU078654
99
1
283
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACAGAGTTGCAAAACTTCCTAAACCATTGTGAACGTTACCTAAACCGTTGCTTCGGCGGGCGGCCCGGGTCCTTCCCGGCGCCCCTCGGCCCTCGCGGGCGCCCGCCGGAGGTAAACCAAACTATTGCATTGTATGGCCTCTCTGAGTCTTCTGTACTGAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCA