to top page


TOP > November 2010 >Unclassified >1337

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1337November 2010UnclassifiedUncultured fungusAB520527
83
1
337
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACAGTAAATTACTGTAGACCTGATGTCTTGGATTAAAACTGTAGTATGAATAAGATCTACTATGTGGCCTATAATAGGCATCCAGCATCGCCTAACCATGTTAACATTAACTGAAGCGTAACCTTTGGCAGATTTTATTTTGCCAGAAGGAAAGCATTAAACTCTTTTCTAATTAAGTTAATAAATCACTATTTATCAGTCTGAAAACAAGTTAATTATATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGC