to top page


TOP > November 2010 >Unclassified >1334

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1334November 2010UnclassifiedUncultured fungusJQ900298
99
4
265
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTATTACTCCAAACCCTTTGTGAACCTTACCTTTTTGTTGCTCGGCGTACCGCGGGCCGTGGCTTCGGCCCGTCCCGCAGCGCGCCAGAGGACCCAACTCTTCAATTTATAGCGTACCTTCTGATTTACAAAACAAACAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCA