to top page


TOP > November 2010 >Unclassified >1333

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1333November 2010UnclassifiedUncultured fungusJN396516
99
1
265
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAGTGAATATTAGCGCATCTACTTGTAGAGCGTGACCTCCACTTTCTAACTCTGTGCATTTATTGGCGGAAGGACTTGAGCAATCGAGTTTCCTTCTGCGGCTCATTTTAAAACACTAGTTAAAGTATGTAACGAAATATCGAAACAAAAAAAACTTTCAACAACGGATCTCTTGGCTTGCGCATCGATGAAGAACGCA