to top page


TOP > November 2010 >Unclassified >1332

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1332November 2010UnclassifiedUncultured fungusFJ784014
99
1
269
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCCTGTGAACATACCTGTTTTGTTGCTTCGGCGGTGCCCTCGCTCTCGTGGCGAGGCCCGCCAGAGGACCCAAACAAACTCTTTGATTTTGATCTAGGATTTTACTTCTGAGTGATATACAAAATAAATCAAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCA