to top page


TOP > November 2010 >Unclassified >1331

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1331November 2010UnclassifiedUncultured fungusFN610881
92
1
274
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACAGAGAACCTCGCCCTTCTGGGTGAATCTCCAACCCTATGCTATACTACTTTGTTGCTTTGGCGAGCCGCTTAGGCCACCGGCTTACGCTGGTGAGTGCTCGCCAGAGAACCCTAAACTCTAAGTTATTAGTGTCGTCTGAGTACTATAAAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCA