to top page


TOP > November 2010 >Unclassified >1327

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1327November 2010UnclassifiedUncultured fungusJN905358
99
2
313
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTAATGAGTTTTCTAAAACTCCAAACCCTTGAGAACATACCTAGTTGCCTCGGCGGACTTGCCCTGGGACGACCTACCCTGCAGCGAGTTACCCTGTAACGAGTTGCCCTGTAGGGACCTGCCCTGTAGCCTGCTCGCCGGCGGCCAACCTAAACTCTGTTTTATTGTGGCACTTCTGAGGATTATTCTAAATGAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAG