to top page


TOP > November 2010 >Unclassified >1326

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1326November 2010UnclassifiedUncultured fungusFJ777533
97
1
272
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTAACGAGTTATCCAAACTCCAAACCTTTGTGAACATTACCGATCGTTGCTTCGGCAGGCGGCTCCGGGGGAGCACGAGGCCATTTCTGTGGCGTCTGCCGAAAGCCCCAAAAACTCATTTTTTCTGGTAAATTACCTGAGTACCAAACAAACAAGTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAG