to top page


TOP > November 2010 >Unclassified >1325

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1325November 2010UnclassifiedFungal endophyte sp.EU686157
93
1
276
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTCCGAACACCCAAACCCCTGTGAACGCACCTATCGTTGCTTCGGCGGGACCGCCCCGGCGCCCTCGTGGCCCGGACCCAGGCGCCCGCCGGAGAACCCAAACTCTTGTTTTAACATCATTGTATCTTCTGAGTGGCACAAGCATATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAG