to top page


TOP > November 2010 >Unclassified >1323

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1323November 2010UnclassifiedUncultured fungusGQ523500
99
2
277
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTCTCCGTAGGTGAACCTGCGGAGGGATCATTACCAGAAGACGCCTCGGCGGAAACGCCGGGGCCTTCGTCCAACCCTTTGTGAACGTATCTCTATTGCCCCGGGGGAATCCCCGCCTGTCATGGGCGTGGGCCCCCGGTGGCCAACTCAAACTCTGTTTTATTGCCGTCTGAGTAACAAACAAATCAAAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAG