to top page


TOP > November 2010 >Unclassified >1320

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1320November 2010UnclassifiedUncultured fungusGQ523500
95
1
279
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTCTCCGTAGGTGAACCTGCGGAGGGATCATTACCAGAAGACGCCTCGGCGGAAACGCCGGGGCCTTCGTCCAACCCTTTGTGAACGTATCTCTATTGCCCCGGGGGAAGTCCCCGCCTGTCATGGGCGTGGGCCCCGGTCGGCAACTCAACTACTGTTTTATTTGCCGTCTGAGTAACAAACAAATACAAACAAAACTTTACTACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAG