to top page


TOP > November 2010 >Unclassified >1319

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1319November 2010UnclassifiedUncultured fungusFJ777183
96
1
275
-

Sequence

CTTGGTCATTTAAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAGCCTGCGGAAGGATCATTCATAATAAGTGTTTTATGGCACTTTTTTAAATACCATATCCACCTTGTGTGCAATGTCAGGGGTTGGGTTTTCTCTCTTTTGTAGAGATCAACCTTAAACATCAACTCTATCTTAACTCTTTGTCTGAAAAAATATTATGAATAAAACAATTCAAAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAG