to top page


TOP > November 2010 >Unclassified >1318

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1318November 2010UnclassifiedUncultured fungusFN812825
99
9
300
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCAATGTGAACGTTACCAAACTGTTGCCTCGGCGGGGTCACGCCCCGGGTGCGTAAAAGCCCCGGAACCAGGCGCCCGCCGGAGGAACCAACCAAACTCTTTCTGTAGTCCCCTCGCGGACGTATTTCTTACAGCTCTGAGCAAAAACTTCAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAG