to top page


TOP > November 2010 >Unclassified >1316

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1316November 2010UnclassifiedUncultured fungusJX984694
99
3
259
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCTAGAGTTTGTAGACTTCGGTCTGCTACCTCTTACCCATGTCTTTTGAGTACCTTCGTTTCCTCGGCGGGTCCGCCCGCCGATTGGACAACATTCAAACCCTTTGTAGTTGCAATCAGCGTCTGAAAAAACATAATAGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAG