to top page


TOP > November 2010 >Unclassified >1315

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1315November 2010UnclassifiedUncultured fungusJN396851
92
2
295
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAATGAACCTCTGAGAGTTGAGCTGGTAATTTATTTGCATGTGCTCGCTCTCTCATCCTTTATACACCTGTGCACTTTTGAGGGGATGAGTAGACTTTTGTAATGAAAGTCAAAATTCCCCTTCAACTACATACACTTTATTATTAATCGAATGTTCAAACGCTTAACAGCATTTAAATACAACTTTTAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAG