to top page


TOP > November 2010 >Unclassified >1311

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1311November 2010UnclassifiedUncultured fungusJN905688
99
4
270
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCACTAGTGATTAAATCGAGCGTGTCTTCATTGACCGCTCACCCTTCTCACCATTCACATACACCTGTGCACTGTTTAGCCTGAGCCGGTTTTCCGGTCCAGGTTATCATTTCATACAAACTCTAGTCTTATGAATGTAAACGTTTTAATAACATAATAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAG