to top page


TOP > November 2010 >Unclassified >1308

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1308November 2010UnclassifiedUncultured soil fungusJQ666523
99
42
278
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTAAGGAGTTGCAAAACTCCCAAACCATTGTGAACATACCTTCAACGTTGCTTCGGCGGGTTGGCCCCGGTCTCCGGGGTCCCCGGCCCTACTCGGGCGCCCGCCGGAGGTATCTAACTCTTGAACTTTTATGGCCTCTCTGAGTCTTTGTACTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAG