to top page


TOP > November 2010 >Unclassified >1307

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1307November 2010UnclassifiedUncultured soil fungusJX489779
98
3
266
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCAGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAAACGTTGCTTCGACGGGAACAGACGGCCCTGTAACAACGGGCCGCCCCCGCCAGAGGACCCCTAACTCTGTTTTCATAATGTTTTTCTGAGTAAACAAGCAAATAAATTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAG