to top page


TOP > November 2010 >Unclassified >1305

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1305November 2010UnclassifiedUncultured fungusJN396913
85
5
302
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGGGTCTAGCGACTGCCCGAACCACTACACTGTGCACTATTTCCAAAAAAATTCTACGCTGCGGCGGGCCGCTCGCTGGAGGGGCCTGGGGCCGAAAGGCTGGCCTGCCAAAGCAACCCCCTAAAATAATTTTGTAAGCACTTCTGAGAGGCGTCGATAGCCTTTTTATTCAAAAGGTAGATCACAACCCACAACAATGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAG