to top page


TOP > November 2010 >Unclassified >1303

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1303November 2010UnclassifiedUncultured fungusFJ777183
99
9
270
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTCATAATAAGTGTTTTATGGCACTTTTTTAAATACCATATCCACCTTGTGTGCAATGTCAGGGTTGGTTTCTCTCTTTTGAGAGATCAACTCCAAACATCAACTCTATCTTAACTCTTTGTCTGAAAAATATTATGAATAAAACAATTCAAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAG