to top page


TOP > November 2010 >Unclassified >1302

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1302November 2010UnclassifiedUncultured fungusFJ758205
91
4
271
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTTCGTAGGTGAACCTGCGGAAGGATCATTAGTGAAGTCTTTTAAGAACGCTCGCAAGAGGTTCGACTACACTTTATCATAACACTGTGAACTTGAAATTCGTAACTTGTCTTTCGGGACTCGTTCGAAACCCTTAGTCTTATTAAACCAGTCTTGAATGTAAACCTTTGATTAAACGAAAGTAACAACTTTCAGCAACGGATTTCTTGGCTCTCGCATCGATGAAGAACGCAG