to top page


TOP > November 2010 >Zygomycota >1301

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1301November 2010ZygomycotaUncultured MortierellaHQ212098
99
6
266
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTACGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTCATAATAAGTGTTTTATGGCACTTTTTAAATCCATATCCACCTTGTGTGCAATGTTTTGAAAATCGCCTTCTTGGTGGTTTTTTAATTACATCAACCAATTTTAACAAATTTGTCTTAAAAATTCTTGAATAAATATAATTCAAAAAACAACTTTTCAACAACGGATCTCTTAGGCTCTCGCATCGATGAAGAACGCA