to top page


TOP > November 2010 >Zygomycota >1300

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1300November 2010ZygomycotaUncultured MortierellalesGQ219867
98
60
273
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTCACAATGAGTGTTTTATGGCACTCTTTAAAAATCCATATCCACCTTGTGTGCAATGTTTGTTGGGAGAGAGGCAACTCTTTCCCTTCACAAATATCAACCTATATCTTTAACAACATTCGTCTGATAACATATTATGAAATTATACTTAATTCAAAATATAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGC