to top page


TOP > November 2010 >Zygomycota >1298

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1298November 2010ZygomycotaUncultured MortierellaFN565294
98
1
286
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTCATAATCAAGTGTTTTTATGGCACTTTCAAAAATCCATATCCACCTTGTGTGCAATGTCATCTCACTGGAGGTCAACGGCTGTAAAAATCCGTTGGTCACCTTTGGGGTTATATCTACTCAGAACTTTAGTGATTTTGTTCTGAACATATTATGAATACTTAATTCAAATACAACTTTCTAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGC