to top page


TOP > November 2010 >Glomeromycota >1297

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1297November 2010GlomeromycotaUncultured GlomeromycotaJX096614
98
5
323
-

Sequence

CTTGGTCATTTTAGAGGAAGTAAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAATATTTGAGTCGGGGTTGTTCTTGTGGTATTCGGTTCGGTTCTTTTTTGTGTCTTTTAGTTATTGAAAAATCCCGGGAATAACCCTGACACAAATATGAACACTTTTTATTTCTCGTTCCCATTTTATGGGAAGGAGCAAGATGGACATATTTAAACCCAACTCTTTAAATGTTTTATAACTATTGTGTATTTTAAATAAAAAAGATCACTTTCAACAACGGATCTCTCGGCTCTCGCATCGATGAAGAACGC