to top page


TOP > November 2010 >Glomeromycota >1296

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1296November 2010GlomeromycotaUncultured GlomusHQ243310
89
1
203
-

Sequence

CTTGGTCATTTAGAGGAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACAAATTTATGGCGAACTTTTCGCCATCATATTTTTCGTATTTAAAATATCCGCCCTTTATAAAAAATTTTGATAAAATTAAAAAAAAGATCACTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCA