to top page


TOP > November 2010 >Glomeromycota >1295

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1295November 2010GlomeromycotaUncultured GlomusAY236264
99
1
220
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATAAATCATGGCGAACCTCGCGTTTCGCGAGGTCTTACGTCCATTTTTCGTATTTAAAACATCCCACTCTTTAAAAATATTTATCTAATGATAAAAATAAAAAGATCACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCA