to top page


TOP > November 2010 >Glomeromycota >1294

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1294November 2010GlomeromycotaUncultured GlomusAM942464
95
2
228
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACAAATCATGGCGAACCTCGCGGTTTCGCGAGGTCATGCGTCCATTTTTTTCGTATTTAAAACATCCCACTCTTTAAAAAAATATATATTTATCCAATGATAAAAATAAAAGATCACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCA