to top page


TOP > February 2012 >Basidiomycota >1123

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1123February 2012BasidiomycotaUncultured StereumFN539062
86
18
305
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAATGAAATTCTGACTGAGGTTGTAGCTGGCGCCCTACCCGCGCATGTGCACGCCTCTTTCACAATCCACTCACACCTGTGCACCTTCGCGTGGGTCCGGGGTAACACCTGGGCTCGCGTCCCTTTTTACAAACTCTTTTGTATGTCCTCAGAATGTACATCATTGATGTCTTTAAAAACGCATCTAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAG