to top page


TOP > February 2012 >Basidiomycota >1122

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1122February 2012BasidiomycotaUncultured SebacinaGQ219832
98
46
290
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGATTGCGAATCGTTGCCTTCAGTGCTGGCCGGCTTCGGCATGTGCACGTTGGTGACTTTCATCCAATACCCCTGTGAACCTTTGGCCTCTTGCTAGCTTTGGCCGGCAGAGGATTTTTTACACAAACTCGAATGTAATGAAATTTATTGTCGTGCGCAAGCACTAATGTACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAG