to top page


TOP > February 2012 >Basidiomycota >1121

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1121February 2012BasidiomycotaUncultured SebacinaGQ219810
97
1
287
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGATTGCGAATCGTTGCCTTCAGTGCTGGCCGGCTTCGGCATGTGCACGTTGGTGACTTTCATCCAATACCCTGTGAACCTTTGGCCTCTTGCTAGCTTTGGCCGGCAGAGGTATTTTTACACAAACTCGAATGTAATGAAAACTATGTTGTGCGCAAGCACTAATGTACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAG