to top page


TOP > February 2012 >Basidiomycota >1120

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1120February 2012BasidiomycotaUncultured RussulaGQ219954
91
1
329
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAATGGAGGTACTGGGGTTGTCGCTAACTTTGTGCACACCTTGGTACTCTCTCACATACAATCCATCTCACCCCTTTTGTGCATCACCGCGTCGGGGACCCCCTTTGGCTAGTTCTGGTAGGGGGGTTTTCACGTTTTACATAGACTACCTTTTAATGACAATGTGTAGAATGTACATTAACTTTTTGCGATCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAG