to top page


TOP > February 2012 >Basidiomycota >1117

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1117February 2012BasidiomycotaUncultured HebelomaJQ724055
98
1
276
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACAGAGTTCATGCCCTCACGGGTAGATCTCCCACCCTTTGAGTACTATACTTTGTTGCTTTGGCAGGCCGCTTCGGCTACCGGCTTCGGCTGGTGAGTGCCTGCCAGAGGACCCCCAAACTCTGAATTATTGTGTCGTCTGAGAACTATATAATAGTTAAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAG