to top page


TOP > February 2012 >Basidiomycota >1116

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1116February 2012BasidiomycotaUncultured CryptococcusHE977548
99
24
225
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAGTGAACGCCCTCACGGGCTTGTAACTATTCCAAACCTCTGTGAACCGTGCCCTTCGGGGCTATTTTACAAACATGGTGTAACTGAACGTCATATATCATAACAAAACAAAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAG