to top page


TOP > February 2012 >Basidiomycota >1115

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1115February 2012BasidiomycotaUncultured CeratobasidiaceaeHM141044
96
1
298
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACTTGCGGAAGGATCATTATTGAATGAATATAGAGTCGGTTGTAGCTGGCCCCTCCGGGGCATGTGCACGCCTTCTCTTTCATCCACACACACCTGTGAACTCGTGAGACGGGGGTAAGCTCTTCGGGCGGACCCGTCTGCTATATTATAAACTCATATATTGTAAAACGAATGTACACGATGTAAACACATCTTTAAACTAAGTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAG