to top page


TOP > February 2012 >Basidiomycota >1112

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1112February 2012BasidiomycotaUncultured BasidiomycotaGU328532
90
34
326
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGAACTTTGAAGGGGAGAGGGGAAGGCTGTCGCTGGCTCTCTCGAGCATGTGCACGCCTTTCCTTCTCTTCATGCAAACCTACACCTGTGCACCCATTGTAGGCCCTCGAAACGAGGATCTACGTATTTCATACAACACCCACTTAGCATGTCCATAGAATGTCAAATCATAGGATCGTCCTTCGGGCGGTATCTACGAAATCAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAACGAACGCAG