to top page


TOP > February 2012 >Basidiomycota >1111

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1111February 2012BasidiomycotaUncultured BasidiomycotaGU328589
91
1
331
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAATGGAGGTACTGGGGTTGTCGCTAACTTTGTGCACACCCTTGGTAACTCTCTCACATACAATCCATCTCACCCCCTTTTTGTGCATCCACCGTGTCGGGGACCCCCTTTGGCTAGTTCTGAGGGGGGTTTTCACGTTTTTACATAGACACCCTTTTAATGCAATCGTGTAGAACTGTCATACTTTTTGCGATCACATGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTTGCATCGATGAAGAACGCAG