to top page


TOP > February 2012 >Basidiomycota >1110

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1110February 2012BasidiomycotaUncultured BasidiomycotaGU328589
90
1
333
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGAAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAATGGAGGTACTGGGGTCGTCGCTAACTTTGTGCACACCTTGGTACTCTCTCACATACAATCCATCTCACCCCCTTTTGCGCATCACCGCGTGGGGACCCCCCTTTGGCTAGTTCTGAGGGGGGGTTTTTTCACGTTTTTTAACATAGACACCCTTTTAATGCAATGTGTAGAATGTCATACTTTTTTAGCGATCACACGCAATCAATACAACTTTCAACAACGGATCTCCTGGTTCTCGCATCGATGAACGAACGCAG