to top page


TOP > February 2012 >Basidiomycota >1107

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1107February 2012BasidiomycotaUncultured BasidiomycotaGU328589
91
1
332
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAATGGAGGTACTGGGGTTGTCGCTAACTTTGTGCACACCTTGGTACTCTCTCACACACAATCCATCTCACCCCGTTTTGTGCATCACCGCGTGGGGTACCCCCCGTTTGGCTAGTTCTGAGGGGGGGTTTTTTCACGTTTTTAACATAGACACCCTTTTAATGCAATGTGTAGAATGTCATACTTTTTAGCGATCACACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCCCTCGCATCGATGAAGAACGCAG