to top page


TOP > February 2012 >Basidiomycota >1105

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1105February 2012BasidiomycotaUncultured BasidiomycotaHM240154
99
7
284
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAGCGAATTAAACATGCTTGGTGTCTTCGCTTCGGCAAGGCCCTTGCTTAAATCACATCCTAACACCTGTGAACTGTAAGACGTATGATGAGGTCTTTGGCCAAGTCATCGTCTGCCCATTTTTAACAAACAATTAATGTAACAAACGTAGTCTTATTATAACATAATAAAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAG