to top page


TOP > February 2012 >Basidiomycota >1102

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1102February 2012BasidiomycotaUncultured BasidiomycotaGU328589
92
1
331
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTACAATGGAGGTACTGGGGTTGTCGCTAACTTTGTGCACACCTTGGTACTCTCTCACATACAATCCATCTCACCCCTTTTGTGCATCACCGCGTGGGGACCCCCTTTGGCTAGTTCTGAGGGGGGTTTTCACGTTTTTACATAGACACCCNTTTTAAACTGCAATGTGTAGAATGTCATACTTTTTGCGATCACACGCAATCAAATCAAACTTTCAACTAACGGATACGTCTTGGCTCTCGCATCGATGAAGAACGCAAG